Open Access
Research Article

Table 1

Primer sequences used for PCR and LAMP.

Primer Sequences (5′→3′) Amplicon sizes (bp)
LAMP
 F3 ACGAGAGTCGGAGAGGGA 202
 B3 TGGATTCCTCTCCTACCCCT
 FIP (F1c−F2) GGATCGCATTCCGGTGTCTCTTAAGATGTTTCCGGCTTGGC
 BIP (B1c−B2) GACGACGCTTTCCTCGTGGTCAAGCCTCCGACTCTGTCT
 FITC-Probe FITC-GGCGGAGAGAATTGAAGAGTGGAGAA
PCR
 F ACGAGAGTCGGAGAGGGA 202
 R TGGATTCCTCTCCTACCCCT