Open Access
Research Article

Table 1

Primers used in this study.

Gene/region Primers and sequences 5′–3′ Cycling conditions References
28S LSU Initial denaturation of 7 min at 95 °C; 40 cycles of 40 s at 95 °C, 45 s at 57 °C and 1 min and 30 s at 72 °C; 10 min at 72 °C for final extension [34, 43]
 TAGGTCGACCCGCTGAAYTTAAGCA
1500R
 GCTATCCTGAGGGAAACTTCG
1200R
 GCATAGTTCACCATCTTTCGG
ITS GLYP1 Initial denaturation of 7 min at 95 °C; 40 cycles of 40 s at 95 °C, 45 s at 57 °C and 1 min 30 s at 72 °C; 10 min at 72 °C for final extension [36, 56]
 GCTGAGAAGACGACCAAACTTGAT
BD2
 TATGCTTAAATTCAGCGGGT
COI JB3 Initial denaturation of 5 min at 94 °C; 40 cycles of 30 s at 92 °C, 45 s at 47 °C and 1 min 30 s at 72 °C; 10 min at 72 °C for final extension [42, 55]
 TTTTTTGGGCATCCTGAGGTTTAT
JB4.5
 TAAAGAAAGAACATAATG AAAATG